glcT [2018-02-10T14:27:27.000Z]

transcriptional antiterminator, controls expression of the ptsG-ptsH-ptsI operon

Locus: BSU13880

Isoelectric point: 7.01

Molecular weight: 33.03 kDa

Protein length: 285 aa

Gene length: 855 bp

Function: control of glucose uptake

Product: transcriptional antiterminator of the ptsG-ptsH-ptsI operon

Essential: no

Synonyms: ykwA

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → Glycolysis
• Information processing → Regulation of gene expression → Transcription factors and their control → PRD-type regulators
• Information processing → Regulation of gene expression → RNA binding regulators
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 1,456,092 → 1,456,958

The protein

Catalyzed reaction/ biological activity

• transcription antiterminator , RNA-binding protein, binds the ptsG RAT sequence

Protein family

• transcription antiterminator of the BglG/ SacY family

Paralogous protein(s)

• LicT, SacT, SacY

Domains

• RNA-binding domain (N-terminal, constitutive antiterminator)
• 2x PTS regulation domains (PRDs) (C-terminal, neg. regulated by PtsG)

Modification

• phosphorylation (His104)

Structure

• 3GWH (PRD-II) PubMed
• 3RIO (RBD-PRD-I) PubMed

Expression and Regulation

Operons

• Genes: papB-ykvZ-glcT
  Description: PubMed

Biological materials

Mutant

• available in Jörg Stülke's lab:
• GP109 (in frame deletion)
• GP777 (ΔglcT-ptsG-ptsH-ptsI::spc) PubMed
• GP926 (ΔglcT-ptsG::tet) PubMed
• BKE13880 (ΔglcT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCAATACCTCATATCGT, downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
• BKK13880 (ΔglcT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCAATACCTCATATCGT, downstream forward: _UP4_TAAATTCAGTTTATCCTTAT

Expression vector

• pGP124 (full length, in pWH844), available in Jörg Stülke's lab
• pGP114 (amino acids 1-60, RNA-binding domain, in pWH844), available in Jörg Stülke's lab
• pGP230 (amino acids 1-60, RNA-binding domain with thrombin cleavage site, in pWH844), available in Jörg Stülke's lab
• pGP164 (both PRDs, in pWH844), in addition diverse expression vectors for phosphorylation site mutants and for RBD mutants (all in pWH844), available in Jörg Stülke's lab
• pGP424 (PRDI, in pWH844), available in Jörg Stülke's lab
• pGP425 (PRDII, in pWH844), available in Jörg Stülke's lab
• pGP442 (PRDI, in pGP570, with thrombin cleavage site), available in Jörg Stülke's lab
• pGP443 (PRDII, in pGP570, with thrombin cleavage site), available in Jörg Stülke's lab
• pGP575 (amino acids 1-60, RNA-binding domain with Strep-tag, in pGP574), available in Jörg Stülke's lab

GFP fusion

• GP1224 (spc, based on pGP1870), available in Jörg Stülke's lab

FLAG-tag construct

• GP1220 (spc, based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany
• Homepage

References

Reviews

Loading

Original publications

Loading